A directed graph G with designated vertices v_in and v_out is said to have a Hamiltonian path (2) if and only if there exists a sequence of compatible "one-way" edges e_1, e_2,...,e_z that begins at v_in, ends at v_out, and enters every other vertex exactly once. Figure 1 shows a graph that for v_in=0 and v_out=6 has a Hamilitonian path, given by the edges 0->1, 1->2, 2->3, 3->4, 4->5, 5->6. If the edge 2->3 were removed from the graph, then the resulting graph with the same designated vertices would not have a Hamiltonian path. Similarly, if the designated vertices were changed to v_in=3 and v_out=5 there would be no Hamiltonian path (because, for example, there are no edges entering vertex 0).
There are well-known algorithms for determining whether an arbitrary directed graph with designated vertices has a Hamiltonian path or not. However, all known algorithms for this problem have worst-case exponential complexity, and hence there are instances of modest size for which there algorithms require an impractical amount of computer time to render a decision. Because the directed Hamiltonian path problem has been proven to be NP-complete, it seem likely that no efficient (that is, polynomial time) algorithm exists for solving it (2,3).
The following (nondeterministic) algorithm solves the directed Hamiltonian path problem:
(4)
7 | \
/ \ \
/ | \
/ \ \
/ | _|
(3)<--------\---(1)
7 |^ |/7 7
/ || __ //_/
/__ || ____/ //|
// || // \
(0) ------------------|------> (6)
\ || // \ 7
\ || // | /
\ || // \ /
_| v|L/ _| /
(2)<---------------(5)
Fig. 1.Directed Graph. When v_in=0 and v_out=6, a unique
Hamiltonian path exists: 0->1, 1->2, 2->3, 3->4, 4->5, 5->6
To implement step 1 of the algorithm, each vertex i in the graph was
associated with a random 20-mmet sequence of DNA denoted O_i. For each edge
i->j in the graph, an olignucleotide O_(i->j) was created that was the 3'
10-mer of O_i (unless i=0, in which case it was all of O_i) followed by the 5'
10-mer of O_j (unless j=6, in which case it was all of O_j). Notice that this
construction preserves edge orientation. For example, O_(2->3) will not be
the same as O_(3->2). The 20-mer olignucleotide with the sequence that is
Watson-Crick complementary to O_i was denoted ^O_i (Fig. 2).
For each vertex i in the graph (except i=0 and i=6) and for each edge i->j in the graph, 50 pmol of ^O_i and 50 pmol of O_(i->j), respectively, were mixed together in a single ligation reaction (4). The ^O_i olignucleotides served as splints to bring olignucleotides associated with compatible edges for ligation (Fig. 2). Hence the ligation reaction resulted in the formation of DNA molecules encoding random paths through the graph.
O_2 TATCGGATCGGTATATCCGA
O_3 GCTATTCGAGCTTAAAGCTA
O_4 GGCTAGGTACCAGCATGCTT
O_(2->3) GTATATCCGAGCTATTCGAG
O_(3->4) CTTAAAGCTAGGCTAGGTAC
^O_3 CGATAAGCTCGAATTTCGAT
|
O_(2->3) v O_(3->4)
G T A T A T C C G A G C T A T T C G A G C T T A A A G C T A G G C T A G G T A C
C G A T A A G C T C G A A T T T C G A T
^O_3
Fig. 2.Encoding a graph in DNA. For each vertex i in the graph,
a random 20-mer oligonucleotide O_i is generated (shown are O_2, O_3, and O_4,
respectively). For edge i->j in the graph, an oligonucleotide O_(i->j) is
derived from the 3' 10-mer of O_i and from the 5' 10-mer of O_j (shown are
O_(2->3) for edge 2->3 and O_(3->4) for edge 3-4). For each vertex i in
the graph, ^O_i is the Watson-Crich complement of O_i (shown is ^O_3, the
complement of O_3). ^O_3 servers as a splint to bind O_(2->3) and O_(3->4)
in preparation for ligation. All olignucleotides are written 5' to 3', except
^O_3.
The scale of this ligation reaction far exceeded what was necessary for
the graph under consideration. For each edge in the graph, approximately 3 x
10^13 copies of the associated oligonucleotide were added to the ligation
reaction. Hence it is likely that many DNA molecules encoding the Hamiltonian
path were created. In theory, the creation of a single such molecule would be
sufficient. As a result, for this graph quantities of olignucleotides less than
an attomole would probably have been sufficient. Alternatively, a much larger
graph could have been processed with the picomole quantities used here.
To implement Step 2 of the algorithm, the product of Step 1 was amplified by ploymerase chain reaction (PCR) using primers O_0 and ^O_6 (5). Thus, only those molecules encoding paths that begin with vertex 0 and end with vertex 6 were amplified. To implement Step 3 of the algorithm, the product of Step 2 was run on an agarose gel, and the 140-base pair (bp) band (corresponding to double-stranded DNA encoding paths entering exactly seven vertices) was excised and soaked in doubly distilled H20 (ddH20) to extract DNA (6). This product was PCR-amplified and gel-purified several times to enhance its purity.
To implement Step 4 of the algorithm, the product of Step 3 was affinity-purified with a biotin-avidin magnetic beads system. This was accomplished by first generating single-stranded DNA from the double-stranded DNA product of Step 3 and the incubating the single-stranded DNA with ^O_i conjugated to magnetic beads (7). Only those single-stranded DNA molecules that contained the sequence ^O_1 (and hence encoded paths that entered vertex 1 at least once) annealed to the bound ^O_1 and were retained. This process was repeated successively with ^O_2, ^O_3, ^O_4, and ^O_5. To implement Step 5, the product of Step 4 was amplified by PCR and run on a gel.
Figure 3 shows the results of these procedures. In Fig. 3A, lane 1 is the result of the ligation reaction in Step 1. The smear with striations is consistent with the construction of molecules encoding random paths through the graph (8). Lanes 2 through 5 show the results of the PCR reaction in Step 2. The dominant bands correspond to the amplification of molecules encoding paths that began at vertex 0 and end at vertex 6.
Figure 3B shows the results of a "graduated PCR" performed on the single-stranded DNA molecules generated from the band excised in step 3. Graduated PCR is a method for "printing" results and is performed by running six different PCR reactions with the use of O_0 as the right primer and ^O_i as the left primer in the ith tube. For example, on the molecules encoding the Hamiltonian path 0->1, 1->2, 2->3, 3->4, 4->5, 5->6, graduated PCR will produce bands of 40, 60, 80, 100, 120 and 140 bp in successive lanes. On the molecules encoding the path 0->1, 1->3, 3->4, 4->5, 5->6, graduated PCR will produce bands of 40, x, 60, 80, 100, and 120 bp in successive lanes, where x denotes absence of a band in lane 2 (coresponding to the ommission of vertex 2 along this path). On molecules encoding the path 0->3, 3->2, 2->3, 3->4, 4->5, 5->6, graduated PCR will produce bands of x, 60, 80-40, 100, 120 and 140 bp in successive lanes, where 80-40 denotes that both a 40-bp and an 80-bp band will be produced in lane 3 (corresponding to the double passage of vertex 3 along this path). The most prominent bands in Fig. 3B appear to be those that would arise from the superposition of the bands predicted for the three paths described above. The bands corresponding to path 0->1, 1->3, 3->4, 4->5, 5->6 were not expected and suggest that the band excised in Step 3 contained contamination from 120-bp molecules. However, such low weight contamination is not a problem because it does not persist through Step 4. Figure 3C shows the results of graduated PCR applied to the molecules in the final product of Step 4. These bands demonstrate that these molecules encode the Hamiltonian path 0->1, 1->2, 2->3, 3->4, 4->5, 5->6 (9).
There were photographs here, labelled A, B, and C. Sorry, I
don't have a scanner.
Fig. 3. Agarose gel electrophoresis of various products of the
experiment. (A) Product of the ligation reaction (lane 1), PCR
amplification of the product of the ligation reaction (lanes 2 through 5), and
molecular weight marker in base pairs (lane 6). (B) Graduated
PCR of the product from Step 3 (lanes 1 through 6); the molecular weight maker
is in lane 7. (C) Graduated PCR of the final product of the
experiment, revealing the Hamiltonian path (lanes 1 through 6); the molecular
weight marker is in Lane 7.
This computation required approximately 7 days of lab work. Step 4 (magnetic bead separation) was the most labor-intensive, requiring a full day at the bench. In general, with use of the algorithm above the number of procedures required should grow linearly with the number of vertices in the graph. The labor required for large graphs might be reduced with use of alternative procedures, automation, or less labor-intensive molecular algorithms.
The number of different oligonucleotides required should grow linearly with the number of edges. The quantity of each oligonucleotide needed is a rather subtle graph theoretic question (8). Roughly, the quantity used should be just sufficient to insure that during the ligation step (Step 1) a molecule encoding a Hamiltonian path will be formed with high probability if such a path exists in the graph. This quantity should grow exponentially with the number of vertices in the graph. The molecular algorithm used here was rather naive and inefficient, and as with classical computation, finding improved algorithms will extend the applicability of the method.
As the computation is scaled up, the possibility of errors will have to be looked at carefully. During Step 1, the occasional ligation of incompatible edge oligonucleotides may result in the formation of molecules encoding "pseudopaths" that do not actually occur in the graph. Although such molecules may be amplified during Step 2 and persist through Step 3, they seem unlikely to survive the separation in Step 4. Nonetheless, at the completion of a computation, it would be prudent to confirm that a putative Hamiltonian path actually occurs in the graph. During the separation step, molecules encoding Hamiltonian paths may fail to bind adequately and be lost, whereas molecules encoding non-Hamiltonian paths may bind nonspecifically and be retained. The latter problem might be mitigated by more stringent or repeated separation procedures. One might deal with the former problem by periodically applying PCR with primers designed to amplify Hamiltonian paths (in the example above, primers O_0 and ^O_6). The balanced use of these techniques may be adequate to control such errors.
The choice of random 20-mer oligonucleotides for encoding the graph was based on the following rationale. First, because 4^20 20-mers oligonucleotides exist, choosing randomly made it unlikely that oligonucleotides associated with different vertices would share long common subsequences that might result in "unintended" binding during the ligation step (Step 1). Second, in was guessed that with high probability potentially deleterious (and presumably rare) features such as severe hairpin loops would not be likely to arise. Finally, choosing 20-mers assured that binding between "splint" and edge oligonucleotides would involved 10 nucleotide paris and would consequently be stable at room temperature. This approach was successful for the small graph considered above; however, how to best process for larger graphs may require addiitional research.
What is the power of this method of computation? It is premature to give definitive answers; however, some remarks seem in order. A typical desktop computer can execute approximately 10^6 operations per second. The fastest supercomputers currently available can execute approximately 10^12 operations per second. If the ligation (concatentation) of two DNA molecules is considered as a single operation and if it is assumed that about half of the approximately 4 x 10^14 edge oligonucleotides in Step 1 were ligated, then during Step 1 approximately 10^14 operations were executed. Clearly, this step could be scaled up considerably, and 10^20 or more operations seems entirely plausible (for example, by using micromole rather than picomole quantities). At this scale, the number of operations per second during the ligation step would exceed that of current supercomputers by more than a thousandfold. Furthermore, hydrolysis of a single molecule of adenosine triphosphate plus pyrophosphate provides the Gibbs free energy (delta G = -8 kcal/mol) for one ligation operation (10,11); hence in principle 1 J is sufficient for approximately 2 x 10^19 such operations.
This is remarkable energy efficiency, considering that the second law of thermodynamics dictates a theorectical maximum of 34 x 10^19 (irreversible) operations per joule (at 300 K) (12,13). Existing supercomputers are far less energy-efficient, execute at most 10^9 operations per joule. The energy consumed during other parts of the molecular computation, such as oligonucleotide synthesis and PCR, should also be small in comparrison to that consumed by current supercomputers. Finally, storing information in molecules of DNA allows for an information density of approximately 1 bit per cubic nanometer, a dramatic improvement over existing storage media such as videotapes, which store information at a density of approximately 1 bit per 10^12 nm^3.
Thus, the potential of molecular computation is impressive. What is not clear is whether such massive number of inexpensive operations can be productively used to solve real computational problems. One major advantage of electronic computers is the variety of operations they provide and the flexibility with which those operations can be applied. Wheras two 100-digit integers can be multiplied quite efficiently on an electronic computer, it would be a daunting task to do such a calculation on a molecular computer using currently available protocols and enzymes (14).
Nonetheless, for certain intrinsically complex problems, such as the directed Hamiltonian path problem where existing electronic computers are very inefficient and where massively parallel searches can be organized to take advantage of the operations that molecular biology currently provides, it is conceivable that molecular computation might compete with electronic computation in the near term. It is a research problem of considerable interest to elucidate the kinds of algorithms that are possible with the use of molecular methods and the kinds of problems that these algorithms can efficiently solve (12, 15, 16).
For the long term, one can only speculate about the prospects for molecular computation. It seems likely that a single molecule of DNA can be used to encode the "instantaneous description" of a Turing machine (17) and that currently available protocols and enzymes could (at least under idealized conditions) be used to induce successive sequence modifications, which would correspond to the execution of the machine. In the future, research in molecular biology may provide improved techniques for manipulating macromolecules. Reseach in chemistry may allow for the development of synthetic designer enzymes. One can imagine the eventual emergence of a general purpose computer consisting of nothing more than a single macromolecule conjugated to a ribosomelike collection of enzymes that act on it.